479 extractive question-and-answer pairs built from 1769333048 RabiesGeneralAspectsLaboratoryDiagnosticTechniques2022, published by ncdc.mohfw.gov.in. The source is a 118-page publication. Source-evidenced topics include rabies, national rabies control program, direct fluorescent antibody test (dfat), direct rapid immunohistochemistry test (drit), nucleic acid amplification tests (naat), lyssaviruses, rabies diagnostics, general aspects. Every answer is a verbatim span of text the source prints, and each row carries the passage it sits in, its offset in that passage, the source quote, the page and the location in the document, so any row can be checked against the original. Question types in the export: 217 factual, 83 relationship, 74 list, 52 table, 36 definition, 30 summary, 3 comparison. 214 of the 479 pairs (44.7%) ask explanatory questions; the remaining 265 are factual or table-based questions. 98.12% of rows pass the corpus quality gate.
This dataset contains 479 extractive question-and-answer pairs derived from the 2022 publication 'Rabies: General Aspects and Laboratory Diagnostic Techniques,' issued by India's National Centre for Disease Control. The questions cover topics such as rabies diagnostics, laboratory techniques, and the National Rabies Control Program. Answers are verbatim excerpts from the source, ensuring accuracy and traceability. The dataset includes various question types, such as factual, relationship, and definition, with explanatory questions making up 44.7% of the total. It provides detailed insights into rabies-related laboratory protocols, clinical features, and preventive measures.
Browse more economy datasets, including other records from the same source when available.
Explore Economy datasets5 - Question and Answer Dataset
Economy · 159 rows
LRF Outlook for Second Half of SW Monsoon Season: 2010 - Question and Answer Dataset
Economy · 30 rows
air2 - Question and Answer Dataset
Health · 169 rows
Microsoft Word - Brief note on NCDC Cooler.doc - pdfMachine from Broadgun Software, http://pdfmachine.com, a great PDF writer utility! - Question and Answer Dataset
Health · 12 rows
Annual Report 2015-16 by agriwelfare.gov.in - Question and Answer Dataset
Economy · 1K+ rows
Higher Education in India - Question and Answer Dataset
Economy · 1.5K+ rows
Gender Policy of NABARD - Question and Answer Dataset
Economy · 14 rows
ICAR Annual Report 2025-26 - Question and Answer Dataset
Economy · 1.1K+ rows
Use the API URL with your free DD token in notebooks, scripts, and pipelines.
https://www.desidata.in/api/datasets/ncdc-mohfw-gov-in-b8c77efb4827d7ebedca8c0fb8be9cf9/downloadDataset downloads are free. For Python or API downloads, sign in once and create a free DD token; set it as DD_TOKEN or save it in your notebook's secrets. Requests are linked to your account so your download history and counts stay accurate.
# One-time install: pip install desidata
# Set DD_TOKEN in your environment first (create a free token in Profile & settings).
import desidata
df = desidata.load("ncdc-mohfw-gov-in-b8c77efb4827d7ebedca8c0fb8be9cf9")
df.head()First 10 of 479 rows
| question | answer | context | answer_start | question_type | knowledge_quality_score | source_document | source_quote | source_page | source_location | confidence | validation_status |
|---|---|---|---|---|---|---|---|---|---|---|---|
| What is the basis of the hemi-nested conventional RT-PCR protocol? | based on pan-lyssavirus RT-PCR protocol from WHO Rabies Laboratory Manual | The hemi-nested conventional RT-PCR protocol is based on pan-lyssavirus RT-PCR protocol from WHO Rabies Laboratory Manual. This assay is based on using degenerative primers to cover most of the genotypes of viruses belonging to lyssavirus species. | 48 | definition | 1.000 | https://ncdc.mohfw.gov.in/uploads/resource/1769333048_RabiesGeneralAspectsLaboratoryDiagnosticTechniques2022.pdf | The hemi-nested conventional RT-PCR protocol is based on pan-lyssavirus RT-PCR protocol from WHO Rabies Laboratory Manual. | 62 | page=62,block=3 | 0.850 | valid |
| What principle are Nucleic Acid Amplification Tests (NAAT) based on? | based on the detection of genomic material of the target organism in the sample | Principle. Nucleic Acid Amplification Tests (NAAT) are based on the detection of genomic material of the target organism in the sample. Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) can be used for Rabies RNA detection in suspected samples after proper standardization and optimization using appropriate controls. | 55 | definition | 1.000 | https://ncdc.mohfw.gov.in/uploads/resource/1769333048_RabiesGeneralAspectsLaboratoryDiagnosticTechniques2022.pdf | Nucleic Acid Amplification Tests (NAAT) are based on the detection of genomic material of the target organism in the sample. | 58 | page=58,block=10 | 0.850 | valid |
| What principle is the rapid antigen detection test (RADT) based on? | based on immunochromatographic principle in lateral flow format | Principle. The rapid antigen detection test (RADT) is based on immunochromatographic principle in lateral flow format. The assay employs a lateral flow device which has an anti- rabies antibody immobilized on a nitrocellulose membrane [19]. | 54 | definition | 1.000 | https://ncdc.mohfw.gov.in/uploads/resource/1769333048_RabiesGeneralAspectsLaboratoryDiagnosticTechniques2022.pdf | The rapid antigen detection test (RADT) is based on immunochromatographic principle in lateral flow format. | 55 | page=55,block=7 | 0.850 | valid |
| What should be done if glycerol saline is unavailable for specimen preservation? | not available: freeze and send at the earliest | Place the specimen in a wide mouth screw-top container (NOT GLASS) and submerge half the specimen in 50% glycerol saline and half in sterile PBS). If glycerol saline is not available: freeze and send at the earliest. A brain specimen is a preferred specimen for post-mortem diagnosis. | 169 | definition | 1.000 | https://ncdc.mohfw.gov.in/uploads/resource/1769333048_RabiesGeneralAspectsLaboratoryDiagnosticTechniques2022.pdf | If glycerol saline is not available: freeze and send at the earliest. | 43 | page=43,block=0 | 0.850 | valid |
| What type of disease is rabies and what does it cause in warm-blooded animals? | a zoonotic viral disease which causes encephalomyelitis in virtually all the warm-blooded animals including man | Rabies: General Aspects 1.1 Introduction abies is a zoonotic viral disease which causes encephalomyelitis in virtually all the warm-blooded animals including man. The causative agent is found in domestic and wild animals and is transmitted to other animals and to humans through close contacts with their saliva (i.e., bites, scratches, licks on broken skin and mucous membranes). | 50 | definition | 1.000 | https://ncdc.mohfw.gov.in/uploads/resource/1769333048_RabiesGeneralAspectsLaboratoryDiagnosticTechniques2022.pdf | Introduction abies is a zoonotic viral disease which causes encephalomyelitis in virtually all the warm-blooded animals including man. | 15 | page=15,block=3 | 0.850 | valid |
| What are the two classifications of rabies in dogs? | dumb (predominantly paralytic manifestation with docile behavior of animal) or furious (mainly convulsions and aggressive behavior with greatly exaggerated biting tendencies) | After an incubation period of around three months (range 10 days to 6 months), dog may manifest one or more of the following clinical features. There may be change in behavior of dog, change in bark tone, change in feeding habits, the animals may go off feed and eat abnormal objects. They may develop fever, vomiting, excessive salivation, paralysis of lower jaw, anxiety, restlessness, convulsions, paralysis leading to death within 5-7 days on onset of disease. There is however no hydrophobia in animals. Rabies in dogs is also classified as dumb (predominantly paralytic manifestation with docile behavior of animal) or furious (mainly convulsions and aggressive behavior with greatly exaggerated biting tendencies). Clinical rabies in dogs has to be differentiated from other diseases which manifest with similar features. | 546 | definition | 1.000 | https://ncdc.mohfw.gov.in/uploads/resource/1769333048_RabiesGeneralAspectsLaboratoryDiagnosticTechniques2022.pdf | Rabies in dogs is also classified as dumb (predominantly paralytic manifestation with docile behavior of animal) or furious (mainly convulsions and aggressive behavior with greatly exaggerated biting tendencies). | ||||
| What do degenerate primers represent in the context of lyssavirus RNA detection? | R – Purine (A/G), V – Not T (A/C/G), W – Weak (A/T), Y – Pyrimidine (C/T), M – Amino (A/C) | detection of lyssavirus RNA Primer/Probe* Sequence Nucleotide Position** Probe LN34 FAM-AA+C+ACCY+C+T+ACA+A+TGGA-BHQ1 59 - 75 Probe LN34lago FAM-AA +C +ACTA +C +T+ACA+A +TGGA-BHQ1 59 - 75 LN34Fwd1 ACGCTTAACAACCAGATCAAAGAA 1 - 24 LN34Fwd2 ACGCTTAACAACAAAATCADAGAAG 1 - 25 LN34Rev CMGGGTAYTTRTAYTCATAYTGRTC 140 - 164 *Details of modifications • LNA-modified bases are indicated by a plus preceding the base in the sequence (e.g. +A, +G, +C, +T) • Degenerate primers [R – Purine (A/G), V – Not T (A/C/G), W – Weak (A/T), Y – Pyrimidine (C/T), M – Amino (A/C)] **Position relative to the Lyssavirus full genome | 465 | definition | 1.000 | https://ncdc.mohfw.gov.in/uploads/resource/1769333048_RabiesGeneralAspectsLaboratoryDiagnosticTechniques2022.pdf | +A, +G, +C, +T) • Degenerate primers [R – Purine (A/G), V – Not T (A/C/G), W – Weak (A/T), Y – Pyrimidine (C/T), M – Amino (A/C)] **Position relative to the Lyssavirus full genome | 66 | page=66,block=6 | 0.700 | valid |
| What is the definition of the serum neutralisation end-point titer? | the dilution factor of the highest serum dilution in which there is a 50% reduction in the number of fluorescing foci | Laboratory Techniques for Diagnosis of Rabies Rabies: General Aspects and Laboratory Diagnostic Techniques 2022 66 • Control slide: 20 fields are observed per well and the number of positive fields (fields with fluorescing foci) are recorded on the RFFIT data sheet. • Test serum: The test serum slides are observed, and the number of positive fields are recorded on the RFFIT data result sheet. • Calculations: Using the control slide and test serum values from the previous example, the test serum end-point titre and international units can be calculated. Determination of 50% end point titres of serum The serum neutralisation end-point titer is defined as the dilution factor of the highest serum dilution in which there is a 50% reduction in the number of fluorescing foci. | 661 | definition | 1.000 | https://ncdc.mohfw.gov.in/uploads/resource/1769333048_RabiesGeneralAspectsLaboratoryDiagnosticTechniques2022.pdf | Determination of 50% end point titres of serum The serum neutralisation end-point titer is defined as the dilution factor of the highest serum dilution in which there is a 50% reduction in the number of fluorescing foci. | ||||
| What is the principle behind the direct fluorescent antibody test for rabies diagnosis? | Rabies-specific antibodies and antigens combine to form an antigen-antibody complex | Principle. When mixed and kept under optimum conditions, Rabies-specific antibodies and antigens combine to form an antigen-antibody complex. This complex is not visible to the naked eye. Fluorescent dyes, like fluorescein isothiocyanate (FITC), can be used to visualize this antigen-antibody complex under a fluorescence microscope. To achieve this, the FITC is tagged with an anti-rabies antibody to form the conjugate. As the conjugate directly binds to the antigen, the process is called the direct fluorescent antibody test (DFAT). Reagents and Equipment. | 57 | definition | 1.000 | https://ncdc.mohfw.gov.in/uploads/resource/1769333048_RabiesGeneralAspectsLaboratoryDiagnosticTechniques2022.pdf | When mixed and kept under optimum conditions, Rabies-specific antibodies and antigens combine to form an antigen-antibody complex. | 48 | page=48,block=5 | 0.700 | valid |
| What is the purpose of the Rapid Fluorescent Focus Inhibition Test (RFFIT)? | to determine the rabies virus antibody level in human or animal sera | Principle. The Rapid Fluorescent Focus Inhibition Test (RFFIT) is a rabies virus neutralisation test carried out in cell culture to determine the rabies virus antibody level in human or animal sera. Immunofluorescence staining is used as an indicator of viral growth. The RFFIT takes 20 hours and is sensitive and accurate in the hands of well-trained laboratory personnel. The protocol for animal samples is slightly different and is available in Manual of Diagnostic Tests and Vaccines for Terrestrial Animals 2022. [22] The RFFIT is performed by mixing dilutions of test sera with a constant amount of rabies virus (50-50% Fluorescing Foci Doses (50 FFD50/100 µl) in a multi chambered slide. | 129 | definition | 1.000 | https://ncdc.mohfw.gov.in/uploads/resource/1769333048_RabiesGeneralAspectsLaboratoryDiagnosticTechniques2022.pdf | The Rapid Fluorescent Focus Inhibition Test (RFFIT) is a rabies virus neutralisation test carried out in cell culture to determine the rabies virus antibody level in human or animal sera. | 72 | page=72,block=16 |
Read straight from the file — download or use the API URL for the full dataset.
| 29 |
| page=29,block=14 |
| 0.700 |
| valid |
| 80 |
| page=80,block=0 |
| 0.700 |
| valid |
| 0.700 |
| valid |